Journal of Traditional Chinese Medicine ›› 2022, Vol. 42 ›› Issue (4): 539-545.DOI: 10.19852/j.cnki.jtcm.20220617.004
• Research Articles • Previous Articles Next Articles
Wenshen Yangxue decoction (温肾养血方) promotes follicular development in aged female mice via stimulation of the silent information regulator 3/forkhead transcription factor O1 3a pathway
ZHANG Liang1, HAN Qian2, YI Yanxiao2, JI Shaoyang3(
), XIN Mingwei2()
- 1 Department of Clinical Laboratory Medicine, Beijing Hospital of Integrated Traditional Chinese and Western Medicine, Beijing 100039, China
2 Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing Maternal and Child Health Care Hospital, Beijing 100026, China
3 Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, China
-
Received:2022-01-11Accepted:2022-04-22Online:2022-08-15Published:2022-07-12 -
Contact:JI Shaoyang,XIN Mingwei -
About author:Prof. JI Shaoyang, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, China. jishaoyang@ipe.ac.cn, Telephone: +86-13552866767
Prof. XIN Mingwei, Department of Traditional Chinese Medicine Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing Maternal and Child Health Care Hospital, Beijing 100026, China. xinmingwei@ccmu.edu.cn;
-
Supported by:Study on the Effect of Wenshen Yangxue Recipe on Improving the Quality of Oocytes in Aged Female Mice based on Sirt3/FoxO3a Pathway(7192068);Research on the Pathogenesis of Methyl Group Deletion Caused by One Novel Mutation of BRCA2 Gene in Patients from Families at Risk of Hereditary Ovarian Cancer and Breast Cancer(8972444)
Cite this article
ZHANG Liang, HAN Qian, YI Yanxiao, JI Shaoyang, XIN Mingwei. Wenshen Yangxue decoction (温肾养血方) promotes follicular development in aged female mice via stimulation of the silent information regulator 3/forkhead transcription factor O1 3a pathway[J]. Journal of Traditional Chinese Medicine, 2022, 42(4): 539-545.
share this article
Table 1Prim er sequence
| Gene name | Forward primer | Reversed primer |
|---|---|---|
| Sirt 3 | ATCCCGGACTTCAGATCCCC | CAACATGAAAAAGGGCTTGGG |
| FOXO 3a | CTGGGGGAACCTGTCCTATG | TCATTCTGAACGCGCATGAAG |
| GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
Table 1Prim er sequence
| Gene name | Forward primer | Reversed primer |
|---|---|---|
| Sirt 3 | ATCCCGGACTTCAGATCCCC | CAACATGAAAAAGGGCTTGGG |
| FOXO 3a | CTGGGGGAACCTGTCCTATG | TCATTCTGAACGCGCATGAAG |
| GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
Figure 1 Effect of Wenshen Yangxue decoction on ovulation number and fertilization ability in older ICR mice A: effect of Wenshen Yangxue decoction on ovulation number in older ICR mice; B: effect of Wenshen Yangxue decoction on the fertilization rate of older ICR mice; C: effect of Wenshen Yangxue decoction on the formation rate of abnormally fertilized eggs in older ICR mice; D: the effect of Wenshen Yangxue decoction on the cleavage rate of older ICR mice; E: the effect of Wenshen Yangxue decoction on the formation rate of blastocysts in older ICR mice. ICR: Institute of Cancer Research; Ctrl: blank group; COH: controlled ovarian hyperstimulation; low dose: Wenshen Yangxue decoction group (16.75 g/kg, low group); mid dose: Wenshen Yangxue decoction group (33.5 g/kg, medium group); high dose: Wenshen Yangxue decoction group (67 g/kg, high group); low dose, mid dose and high dose received the same ovarian hyperstimulation as COH. Ctrl and COH were given normal saline by gavage every day. Low dose, mid dose and high dose were given corresponding Chinese medicine suspensions. Mice in each group were reared in separate cages with food and water provided ad libitum. The temperature of the rearing room was maintained at (20 ± 1) ℃, the relative humidity was approximately 50%, and a photoperiod of 14 L: 10 D was adopted. Significant differences compared with COH group were designated as aP < 0.05.
Figure 1 Effect of Wenshen Yangxue decoction on ovulation number and fertilization ability in older ICR mice A: effect of Wenshen Yangxue decoction on ovulation number in older ICR mice; B: effect of Wenshen Yangxue decoction on the fertilization rate of older ICR mice; C: effect of Wenshen Yangxue decoction on the formation rate of abnormally fertilized eggs in older ICR mice; D: the effect of Wenshen Yangxue decoction on the cleavage rate of older ICR mice; E: the effect of Wenshen Yangxue decoction on the formation rate of blastocysts in older ICR mice. ICR: Institute of Cancer Research; Ctrl: blank group; COH: controlled ovarian hyperstimulation; low dose: Wenshen Yangxue decoction group (16.75 g/kg, low group); mid dose: Wenshen Yangxue decoction group (33.5 g/kg, medium group); high dose: Wenshen Yangxue decoction group (67 g/kg, high group); low dose, mid dose and high dose received the same ovarian hyperstimulation as COH. Ctrl and COH were given normal saline by gavage every day. Low dose, mid dose and high dose were given corresponding Chinese medicine suspensions. Mice in each group were reared in separate cages with food and water provided ad libitum. The temperature of the rearing room was maintained at (20 ± 1) ℃, the relative humidity was approximately 50%, and a photoperiod of 14 L: 10 D was adopted. Significant differences compared with COH group were designated as aP < 0.05.
Figure 2 Effect of Wenshen Yangxue decoction on mitochondria on the oocytes of older ICR mice A: effect of Wenshen Yangxue decoction on the ATP content in mouse oocytes the ATP content in mouse oocytes; B: effect of Wenshen Yangxue decoction on the number of mtDNA copies in mouse oocytes. ATP: adenosine triphosphate; mtDNA: mitochondrial DNA; Ctrl: blank group; COH: controlled ovarian hyperstimulation; low dose: Wenshen Yangxue decoction group (16.75 g/kg, low group); high dose: Wenshen Yangxue decoction group (33.5 g/kg, high group); low dose and high dose received the same ovarian hyperstimulation as COH. Ctrl and COH were given normal saline by gavage every day. Low dose and high dose were given corresponding Chinese medicine suspensions. Mice in each group were reared in separate cages with food and water provided ad libitum. The temperature of the rearing room was maintained at (20 ± 1) ℃, the relative humidity was approximately 50%, and a photoperiod of 14 L: 10 D was adopted. Significant differences compared with COH group were designated as aP < 0.05.
Figure 2 Effect of Wenshen Yangxue decoction on mitochondria on the oocytes of older ICR mice A: effect of Wenshen Yangxue decoction on the ATP content in mouse oocytes the ATP content in mouse oocytes; B: effect of Wenshen Yangxue decoction on the number of mtDNA copies in mouse oocytes. ATP: adenosine triphosphate; mtDNA: mitochondrial DNA; Ctrl: blank group; COH: controlled ovarian hyperstimulation; low dose: Wenshen Yangxue decoction group (16.75 g/kg, low group); high dose: Wenshen Yangxue decoction group (33.5 g/kg, high group); low dose and high dose received the same ovarian hyperstimulation as COH. Ctrl and COH were given normal saline by gavage every day. Low dose and high dose were given corresponding Chinese medicine suspensions. Mice in each group were reared in separate cages with food and water provided ad libitum. The temperature of the rearing room was maintained at (20 ± 1) ℃, the relative humidity was approximately 50%, and a photoperiod of 14 L: 10 D was adopted. Significant differences compared with COH group were designated as aP < 0.05.
Figure 3 Effect of Wenshen Yangxue decoction on the expression of mitochondria-related genes
Figure 3 Effect of Wenshen Yangxue decoction on the expression of mitochondria-related genes
| 1 | Katz-Jaffe MG, Lane SL, Parks JC, et al. Antioxidant intervention attenuates aging-related changes in the murine ovary and oocyte. Life (Basel) 2020; 10: 250. |
| 2 |
Zhao HC, Ding T, Ren Y, et al. Role of sirt3 in mitochondrial biogenesis and developmental competence of human in vitro matured oocytes. Hum Reprod 2016; 31: 607-22.
DOI URL |
| 3 | Zhou J, Xue Z, He HN, et al. Resveratrol delays postovulatory aging of mouse oocytes through activating mitophagy. Aging (Albany, NY) 2019; 11: 11504-19. |
| 4 | Lu H, Wang BG, Zhang L, et al. Advances in sirt3 regulation of cellular autophagy. Dong Wu Yi Xue Jin Zhan 2021; 42: 111-5. |
| 5 |
Xin MW, He JQ, Zhang Y, et al. Chinese herbal decoction of Wenshen Yangxue formula improved fertility and pregnancy rate in mice through PI3K/Akt signaling. J Cell Biochem 2019; 120: 3082-90.
DOI URL |
| 6 | He JQ, Zhu P, Li MY, et al. Efficacy of Chinese medicine sequential periodic therapy on the elderly patients with poor ovarian response in IVF-ET. Zhong Guo Zhong Xi Yi Jie He Za Zhi 2020; 40: 1032-7. |
| 7 | Wang JS, Zhang Y, Yang W, et al. Effects of Wenshen Yangxue granules on ovarian reserve function and endometrial morphology of rats with diminished ovarian reserve. Zhong Hua Zhong Yi Yao Za Zhi 2021; 36: 2931-5. |
| 8 |
Patel R, Moffatt JD, Mourmoura E, et al. Effect of reproductive ageing on pregnant mouse uterus and cervix. J Physiol 2017; 595: 2065-84.
DOI URL |
| 9 |
Ackert-Bicknell CL, Anderson LC, Sheehan S, et al. Aging research using mouse models. Curr Protoc Mouse Biol 2015; 5: 95-133.
DOI PMID |
| 10 | Duan W, Cheng Y. Sequential therapy for kidney-tonifying via Traditional Chinese Medicine effectively improves the reproductive potential and quality of life of women with decreased ovarian reserve: A randomized controlled study. Am J Transl Res 2021; 13: 3165-73. |
| 11 |
Lliberos C, Liew SH, Zareie P, et al. Evaluation of inflammation and follicle depletion during ovarian ageing in mice. Sci Rep 2021; 11: 278.
DOI URL |
| 12 | Liu MJ, Chen H, Li W, et al. Srt1720 enhances maturity and quality of oocytes in aged mice. Anim Sci J 2021; 92: e13608. |
| 13 |
Ma H, Hayama T, Van Dyken C, et al. Deleterious mtDNA mutations are common in mature oocytes. Biol Reprod 2020; 102: 607-19.
DOI URL |
| 14 | Xin MW, He JQ, Yang W, et al. Wenshen Yangxue decoction improves endometrial receptivity recovery and promotes endometrial angiogenesis in a rat model. PharmBiol 2018; 56: 573-9. |
| 15 |
Boucret L, Bris C, Seegers V, et al. Deep sequencing shows that oocytes are not prone to accumulate mtDNA heteroplasmic mutations during ovarian ageing. Hum Reprod 2017; 32: 2101-9.
DOI URL |
| 16 | Busnelli A, Navarra A, Levi-Setti PE. Qualitative and quantitative ovarian and peripheral blood mitochondrial DNA (mtDNA) alterations: Mechanisms and implications for female fertility. Antioxidants (Basel) 2021; 10: 55. |
| 17 |
Zhang T, Xi Q, Wang D, et al. Mitochondrial dysfunction and endoplasmic reticulum stress involved in oocyte aging: An analysis using single-cell RNA-sequencing of mouse oocytes. J Ovarian Res 2019; 12: 53.
DOI PMID |
| 18 |
Pasquariello R, Ermisch AF, Silva E, et al. Alterations in oocyte mitochondrial number and function are related to spindle defects and occur with maternal aging in mice and humans. Biol Reprod 2019; 100: 971-81.
DOI PMID |
| 19 | St John J. The control of mtDNA replication during differentiation and development. Biochim Biophys Acta 2014; 1840: 1345-54. |
| 20 |
Fan LH, Wang ZB, Li QN, et al. Absence of mitochondrial DNA methylation in mouse oocyte maturation, aging and early embryo development. Biochem Biophys Res Commun 2019; 513: 912-8.
DOI URL |
| 21 |
Mobarak H, Heidarpour M, Tsai PJ, et al. Autologous mitochondrial microinjection; a strategy to improve the oocyte quality and subsequent reproductive outcome during aging. Cell Biosci 2019; 9: 95.
DOI URL |
| 22 |
Maidarti M, Anderson RA, Telfer EE. Crosstalk between PTEN/PI3K/Akt signalling and DNA damage in the oocyte: Implications for primordial follicle activation, oocyte quality and ageing. Cells 2020; 9: 200.
DOI URL |
| 23 |
Ruankham W, Suwanjang W, Wongchitrat P, et al. Sesamin and sesamol attenuate H2O2-induced oxidative stress on human neuronal cells via the sirt1-sirt3-foxo3a signaling pathway. Nutr Neurosci 2021; 24: 90-101.
DOI |
| 24 |
Liu J, Wang Y, Hao Y, et al. 5-Heptadecylresorcinol attenuates oxidative damage and mitochondria-mediated apoptosis through activation of the sirt3/foxo3a signaling pathway in neurocytes. Food Funct 2020; 11: 2535-42.
DOI URL |
| 25 |
Wang S, Yang J, Lin T, et al. Excessive production of mitochondrion-derived reactive oxygen species induced by titaniumions leads to autophagic cell death of osteoblasts via the sirt3/sod2 pathway. Mol Med Rep 2020; 22: 257-64.
DOI URL |
| 26 | Shi Y, He R, Yang Y, et al. Potential relationship between sirt3 and autophagy in ovarian cancer. Oncol Lett 2020; 20: 162. |
| 27 |
Iljas JD, Homer HA. Sirt3 is dispensable for oocyte quality and female fertility in lean and obese mice. FASEB J 2020; 34: 6641-53.
DOI URL |
| 28 | Xin Y, Jin Y, Ge J, et al. Involvement of sirt3-gsk3beta deacetylation pathway in the effects of maternal diabetes on oocyte meiosis. Cell Prolif 2021; 54: e12940. |
| [1] | LI Xingjie, LIU Qiqi, XIA Rui, LIU Jun, WANG Dan, SHI Jiao, KUANG Yuxing, DAI Yalan, HUANG Haoyu, TANG Wei, CHEN Shangjie. Moxibustion modulates working memory in patients with amnestic mild cognitive impairment: a functional magnetic resonance imaging study [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 801-808. |
| [2] | ZHANG Zhou, MU Jiedan, MA Liangxiao, YU Wenyan, SUN Tianyi, QIAN Xu, TIAN Yuan, ZHANG Yidan, WANG Junxiang. Waggle needling Yanglingquan (GB34) enhances cerebral blood flow and ameliorates condition of spastic paresis in rats with middle cerebral artery occlusion induced by surgical nylon suture [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 514-522. |
| [3] | XIN Zhixiong, LI Jiyuan, XU Yanni, LING Jing, JIANG Min, YU Yutian. Acupuncture on intrauterine growth restriction associated brain injury: case study including use of magnetic resonance imaging [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 602-605. |
| [4] | LI Yue, WEN Shuting, ZHAO Runyuan, FAN Dongmei, ZHAO Dike, LIU Fengbin, MI Hong. Efficacy of active ingredients in Qingdai (Indigo Naturalis) on ulcerative colitis: a network pharmacology-based evaluation [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 124-133. |
| [5] | YANG Jun, XIONG Jun, XU Shaozhong, XIE Hongwu, XIANG Jie. Effect and cerebral mechanism of moxibustion at heat-sensitized Yaoyangguan (GV3) in patients with lumbar disc herniation and myofascial pain syndrome by resting-state functionality magnetic resonance imaging: protocol for an observational study [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 175-180. |
| [6] | CHEN Limei, SUN Jifei, GUO Chunlei, LI Xiaojiao, WANG Zhi, Hong Yang, FANG Jiliang. Preliminary single-arm study of brain effects during transcutaneous auricular vagus nerve stimulation treatment of recurrent depression by resting-state functional magnetic resonance imaging [J]. Journal of Traditional Chinese Medicine, 2022, 42(5): 818-824. |
| [7] | FAN Xisheng, DU Xiaoyi, PAN Lijia, SONG Xiaodan, LIU Jun, ZHANG Juncha, CHEN Hao, GAO Yayu, ZHANG Mingjian, SHI Xuliang, SHE Yanfen. An infrared thermographic analysis of the sensitization acupoints of women with primary dysmenorrhea [J]. Journal of Traditional Chinese Medicine, 2022, 42(5): 825-832. |
| [8] | Li Zhengjie, Zhou Jun, Cheng Shirui, Lan Lei, Sun Ruirui, Liu Mailan, Yang Jie, Gao Yujie, Guo Taipin, Gong Qiyong, Zeng Fang, Liang Fanrong. Cerebral fractional amplitude of low-frequency fluctuations may predict headache intensity improvement following acupuncture treatment in migraine patients [J]. Journal of Traditional Chinese Medicine, 2020, 40(6): 1041-1051. |
| [9] | Wang Qiang, Yang Jing, Lei Yan, Xiu Chengkui, Huo Yanming, Shi Hang. Effects of extracts from Renshen(Radix Ginseng), Sanqi(Radix Notoginseng), and Chuanxiong(Rhizoma Chuanxiong) on F-actin in senescent microvascular endothelial cells [J]. Journal of Traditional Chinese Medicine, 2020, 40(3): 376-385. |
| [10] | Lai Xiaohua, Xiu Chengkui, Wang Xue, Fang Jingyi, Yang Jing, Lei Yan. Efficacy of Renshen Sanqi Chuanxiong formula for preventing vascular aging [J]. Journal of Traditional Chinese Medicine, 2019, 39(06): 780-793. |
| [11] | Xu Gang, Xi Qianhui, Tang Wenchao, Liu Tangyi, Gao Ming, Li Shaoxiong, Wen Junling, Yang Huayuan. Effect of different twirling and rotating acupuncture manipulation techniques on the blood flow perfusion at acupoints [J]. Journal of Traditional Chinese Medicine, 2019, 39(05): 730-739. |
| [12] | Zhao Zhengxiao, Liu Lumei, Tang Zihui, Mohammadtursun Nabijan, Lu Linwei, Li Mihui, Lü Yibao, Mo Shuming, Ma Wenjuan, Wang Meng, Wei Ying, Gong Weiyi, Dong Jingcheng. Kidney-Qi deficiency diagnosed by Deng's diagnosis standard was not correlated with aging based on clinical observation of 90 participants [J]. Journal of Traditional Chinese Medicine, 2019, 39(02): 267-274. |
| [13] | Xu Wenjuan, Han Qinrui, Liang Shuntian, Li Lu, Shao Meng, Yao Xueqing, Sun Xuegang. Modified Shenlingbaizhu decoction reduces intestinal adenoma formation in adenomatous polyposis coli multiple intestinal neoplasia mice by suppression of hypoxia-inducible factor 1α-induced CD4+CD25+forkhead box P3 regulatory T cells [J]. Journal of Traditional Chinese Medicine, 2018, 38(01): 22-32. |
| [14] | Wu Ping, Zeng Fang, Li Yongxin, Li Ji, Qiu Lihua, Qin Wei, Luo Lu, Yin Canxin, Xiong Yan, Bai Yu, Wang Dan, Zhou Yumei, Liang Fanrong. Effect of acupuncture plus conventional treatment on brain activity in ischemic stroke patients: a regional homogeneity analysis [J]. Journal of Traditional Chinese Medicine, 2017, 37(05): 650-658. |
| [15] | Lu Fengyan, Gao Junhong, Wang Yuanyuan, Dai Qiufu, Bao Yan, Hong Yang, Zhang Guolei, Xin Juanjuan, Zhao Yuxue, Wu Shuyang, Chen Yuanyuan, Li Xiaojiao, Fang Jiliang, Yu Xiaochun. Effects of three needling manipulations of the right-side Zusanli(ST 36) on brain using functional magnetic resonance imaging [J]. Journal of Traditional Chinese Medicine, 2017, 37(03): 298-307. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
