Journal of Traditional Chinese Medicine ›› 2022, Vol. 42 ›› Issue (4): 565-575.DOI: 10.19852/j.cnki.jtcm.20220608.001
• Research Articles • Previous Articles Next Articles
ZHANG Zhaohua1, LIU Rong1, DU Nana3, ZHU Xiangdong1,2()
Received:
2022-01-18
Accepted:
2022-04-15
Online:
2022-08-15
Published:
2022-07-12
Contact:
ZHU Xiangdong
About author:
Prof. ZHU Xiangdong, School of Basic Medicine, Gansu university of Chinese Medicine, Lanzhou 730000, China. zhuxiangdong33@163.com, Telephone: +86-15339312501Supported by:
ZHANG Zhaohua, LIU Rong, DU Nana, ZHU Xiangdong. Efficacy of Sishen Wan (四神丸) on dinitrobenzene sulfonic acid-induced ulcerative colitis and its effect on toll-like receptor 2/interleukin-1 receptor-associated kinase-4/nuclear factor-κB signal pathway[J]. Journal of Traditional Chinese Medicine, 2022, 42(4): 565-575.
Gene name | F: 5’→3’ | R: 5’→3’ |
---|---|---|
TLR2 | GGAGGTCTCCAGGTCAAATCT | ATTCCGCTGGACTCCAATGT |
MyD88 | TATACCAACCCTTGCACCAAGTC | TCAGGCTCCAAGTCAGCTCATC |
IRAK4 | AATTGTGGGCACAACGGCTTA | TTCATCCACAGCCGCAAGTC |
NF-κB p65 | ATCCCTGCTTCCCCTTTCTC | CTGTCTTATGGCTGAGGTCTGGT |
β-actin | TACAACCTTCTTGCAGCTCCT | CCTTCTGACCCATACCCACC |
Table 1 primer sequence
Gene name | F: 5’→3’ | R: 5’→3’ |
---|---|---|
TLR2 | GGAGGTCTCCAGGTCAAATCT | ATTCCGCTGGACTCCAATGT |
MyD88 | TATACCAACCCTTGCACCAAGTC | TCAGGCTCCAAGTCAGCTCATC |
IRAK4 | AATTGTGGGCACAACGGCTTA | TTCATCCACAGCCGCAAGTC |
NF-κB p65 | ATCCCTGCTTCCCCTTTCTC | CTGTCTTATGGCTGAGGTCTGGT |
β-actin | TACAACCTTCTTGCAGCTCCT | CCTTCTGACCCATACCCACC |
Figure 1 Effects of SSW on body weight, DAI score and CMDI score of UC model rats A: body weight in each groups; B: CMDI scores in each groups; C: DAI scores in each group. Blank: the normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d. Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis; CMDI: colonic mucosal damage index; DAI: disease activity index. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
Figure 2 SSW improved the pathological lesions of colon tissue in UC model rats (hematoxylin-eosin staining) A: the pathological lesions of colon tissue in each groups rats observed in under 40× light microscope; B: the pathological lesions of colon tissue in each groups rats observed in under 100× light microscope. The black arrow indicates infiltrating inflammatory cells and the red arrow indicates damaged intestinal mucosa. Blank: the normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis.
Figure 3 SSW alleviated the apoptosis of colonic cells in UC model rats A: apoptotic cells (Green) in colon tissue were detected through TUNNEL staining (× 200); B: statistically analyzed by Image J software and GraphPad Prism 7.0. Blank: The normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis, TUNNEL: terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
Figure 4 SSW reduced the level of IL-1 and TNF-α in colon tissues of UC model rats (ELISA assay) Blank: The normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis, IL-1β: interleukin-1β; TNF-α: tumor necrosis factor-α. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
Figure 5 SSW reduced the level of TLR2, MyD88, IRAK4 and NF-κB p65 mRNAs in colon tissue of UC model rats, which were detected by qPCR Blank: the normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis; qPCR: quantitative real-time polymerase chain reaction; TLR2: toll-like receptor 2; MyD88: myeloid differentiation primary response gene 88; IRAK4: interleukin-1 receptor-associated kinase-4; NF-κB p65: nuclear factor-κB p65. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
Figure 6 SSW reduced the level of TLR2, MyD88, IRAK4 and NF- κB p65 proteins in colon tissue of UC model rats Immunohistochemistry (A, × 200) and Western Blotting assay (C) were used to detect the protein expression in colon tissue, respectively. The immunohistochemical images and Western Bloting bands were semi-quantitatively analyzed by Image J software (C, D). Blank: The normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis; TLR2: toll-like receptor 2; MyD88: myeloid differentiation primary response gene 88; IRAK4: interleukin-1 receptor-associated kinase-4; NF-κB p65: nuclear factor-κB p65. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
Figure 7 SSW reduced the level of NF-κB p65 protein in the nucleus of colon tissue of UC model rats Western Blotting assay (A) were used to detect the protein expression, and the intensities of Western Bloting bands were semi-quantitatively analyzed by Image J software (B). Blank: The normal rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Model: UC rats administered with an equal volume of distilled water via oral gavage once a day for 21 d; Mesalazine: UC rats administered with 0.36 g/kg mesalazine via oral gavage once a day for 21 d; High-, Medium-, Low-dose SSW: UC rats administered with SSW via oral gavage at the doses of 24, 12, and 6 g/kg, respectively. SSW: Sishen Wan; UC: ulcerative colitis; NF-κB p65: nuclear factor-κB p65; p-NF-κB: phosphorylated NF-kB. aP < 0.05 vs Blank group; bP < 0.05 vs Model group.
1 |
Eisenstein M. Ulcerative colitis: towards remission. Nature 2018; 563: S33.
DOI URL |
2 |
Kobayashi T, Siegmund B, Le Berre C, et al. Ulcerative colitis. Nat Rev Dis Primers 2020; 6: 73.
DOI URL |
3 |
Ungaro R, Mehandru S, Allen PB, et al Ulcerative colitis. Lancet 2017; 389: 1756-70.
DOI PMID |
4 |
Ramos GP, Papadakis KA. Mechanisms of disease: inflammatory bowel diseases. Mayo Clin Proc 2019; 94: 155-65.
DOI URL |
5 |
Du L, Ha C. Epidemiology and pathogenesis of ulcerative colitis. Gastroenterol Clin North Am 2020; 49: 643-54.
DOI URL |
6 | Wehkamp J, Stange EF. Recent advances and emerging therapies in the non-surgical management of ulcerative colitis. F1000Res 2018; 7: F1000 Faculty Rev-1207. |
7 |
Zheng L, Wen XL, Dai YC. Mechanism of Jianpi Qingchang Huashi Recipe in treating ulcerative colitis: A study based on network pharmacology and molecular docking. World J Clin Cases 2021; 9: 7653-70.
DOI PMID |
8 | Chen W, He L, Zhong L, et al. Identification of active compounds and mechanism of Huangtu decoction for the treatment of ulcerative colitis by network pharmacology combined with experimental verification. Drug Des Devel Ther 2021; 15: 412540. |
9 | Zhang C, Zhu H, Jie H, et al. Arbutin ameliorated ulcerative colitis of mice induced by dextran sodium sulfate (DSS). Bioengineered 2021; 12: 11707-15. |
10 | Wang B, Liu Y, Sun J, et al. Exploring the potential mechanism of Xiaokui Jiedu Decoction for ulcerative colitis based on network pharmacology and molecular docking. J Healthc Eng 2021; 2021: 1536337. |
11 |
Tan YY, Ding Y, Zheng X, et al. Ding's herbal enema treats dextran sulfate sodium-induced colitis in mice by regulating the gut microbiota and maintaining the Treg/Th17 cell balance. Exp Ther Med 2021, 22: 1368-79.
DOI URL |
12 | Ma JZ. Effect of Sishen Wan combined with Shenling Baizhu San on ulcerative colitis of spleen kidney Yang deficiency type. Hefei: Anhui University of Chinese Medicine, 2021: 12-56. |
13 | Cheng XH, Zhang QL, Gong XL, et al. Clinical study on Sishen Pills combined with mesalazine in treatment of ulcerative colitis. Xian Dai Yao Wu Yu Lin Chuang 2018; 33: 1085-8. |
14 | Xie H, Ming H. Sishen Pill combined with vesiculation cupping in the treatment of Yang deficiency of spleen and kidney diarrhoea for 30 Cases. Zhong Guo Zhong Yi Yao Xian Dai Yuan Cheng Jiao Yu 2019; 17: 73-5. |
15 |
Zhao HM, Liu Y, Huang XY, et al. Pharmacological mechanism of Sishen Wan(®) attenuated experimental chronic colitis by inhibiting wnt/β-catenin pathway. J Ethnopharmacol 2019; 240: 111936.
DOI URL |
16 |
Wang HY, Zhao HM, Wang Y, et al. Sishen Wan(®) ameliorated trinitrobenzene-sulfonic-acid-induced chronic colitis via NEMO/NLK signaling pathway. Front Pharmacol 2019; 10: 170-80.
DOI URL |
17 | Wang G, Xu B, Shi F, et al. Protective effect of methane-rich saline on acetic acid-induced ulcerative colitis via blocking the TLR4/NF-κB/MAPK pathway and promoting IL-10/JAK1/STAT3-mediated anti-inflammatory response. Oxid Med Cell Longev 2019; 2019: 7850324. |
18 |
Yang C, Guo X, Wang J, et al. Relationship between small intestinal bacterial overgrowth and peripheral blood ET, TLR2 and TLR4 in ulcerative colitis. J Coll Physicians Surg Pak 2020; 30: 245-9.
DOI URL |
19 | Zhang XX, Li XN, Hu S, et al. Simultaneous determination of nine bioactive components in Sishen Pills by HPLC-ESI-MS/MS. Zhong Cao Yao 2018; 49: 2070-5. |
20 | Zheng J, Cao ZB, Zhu Y. Discussion on establishment and evaluation of ulcerative colitis animal models with spleen-kidney yang deficiency pattern based on the theory of "combination of disease with syndrome". Zhong Guo Zhong Yi Yao Xin Xi Za Zhi 2016; 23: 16-8. |
21 | Wu YH, Xu YQ, Li HL, et al. Preparation of a rat model of ulcerative colitis with spleen and kidney Yang deficiency. Zhong Guo Shi Yan Dong Wu Xue Bao 2016; 24: 116-9. |
22 | Cheng XL, Zhu XD, Wang Y, et al. Effects of Sishen Wan on the contents of serum IL-23 and IL-27 and the expression of Foxp3 mRNA in colonic mucosa of rats with ulcerative colitis. Zhong Yi Yan Jiu 2016; 29: 66-70. |
23 |
Totsuka T, Kanai T, Iiyama R, et al. Ameliorating effect of anti-inducible costimulator monoclonal antibody in a murine model of chronic colitis. Gastroenterol 2003; 124: 410-21.
DOI URL |
24 |
Ke J, Bian X, Liu H, et al. Edaravone reduces oxidative stress and intestinal cell apoptosis after burn through up-regulating miR-320 expression. Mol Med 2019; 25: 54.
DOI URL |
25 | Liu D, Huang X, Cheng S, et al. Regulation of sishen wan on Bax/Bcl-2 mRNA, Fas/FasL in colonic tissue from rats with colitis. Zhong Guo Zhong Yao Za Zhi 2011; 36: 3484-8. |
26 | Wang Y, Liu R, Zhu XD. Immunohistochemical effect of sishen pill on PI3K /Akt/mTOR signal pathway in colonic tissue of rats with ulcerative colitis model of spleen kidney Yang deficiency. Zhong Guo Shi Yan Dong Wu Xue Bao 2021; 29: 42-8. |
27 | Liu R, Wang Y, Zhu XD, et al. Effect of Sishenwan on PI3K/Akt/mTOR signal pathway in colonic tissue of rats with ulcerative colitis model of spleen kidney Yang deficiency. Zhong Guo Shi Yan Fang Ji Xue Za Zhi 2021; 27: 16-23. |
28 | Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol 2009; 1: a001651. |
29 |
Dolcet X, Llobet D, Pallares J, et al. NF-kB in development and progression of human cancer. Virchows Arch 2005; 446: 475-82.
DOI URL |
30 |
Kunnumakkara AB, Shabnam B, Girisa S, et al. Inflammation, NF-κB, and chronic diseases: how are they linked? Crit Rev Immunol 2020; 40: 1-39.
DOI PMID |
31 |
Chen Y, Chen Y, Cao P, et al. Fusobacterium nucleatum facilitates ulcerative colitis through activating IL-17F signaling to NF-κB via the upregulation of CARD3 expression. J Pathol 2020; 250: 170-82.
DOI URL |
32 | Gray CM, Remouchamps C, Mccorkell KA, et al. Noncanonical NF-κB signaling is limited by classical NF-κB activity. Sci Signal 2014; 7:ra13. |
33 |
Liu AH, Wu YT, Wang YP. MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway. Brain Res Bull 2017; 132: 139-49.
DOI URL |
34 |
Torrealba N, Vera R, Fraile B, et al. TGF-β/PI3K/AKT/mTOR/NF-kB pathway. Clinicopathological features in prostate cancer. Aging Male 2020; 23: 801-11.
DOI |
35 |
Candia E, Díaz-Jiménez D, Langjahr P, et al. Increased production of soluble TLR2 by lamina propria mononuclear cells from ulcerative colitis patients. Immunobiology 2012; 217: 634-42.
DOI PMID |
36 | Tan Y, Zou KF, Qian W, et al. Expression and implication of toll-like receptors TLR2, TLR4 and TLR9 in colonic mucosa of patients with ulcerative colitis. Hua Zhong Ke Ji Da Xue Xue Bao Yi Xue Ban 2014; 34: 785-90. |
37 |
Pennini ME, Perkins DJ, Salazar AM, et al. Complete dependence on IRAK4 kinase activity in TLR2, but not TLR4, signaling pathways underlies decreased cytokine production and increased susceptibility to Streptococcus pneumoniae infection in IRAK4 kinase-inactive mice. J Immunol 2013; 190: 307-16.
DOI PMID |
38 | Padwal MK, Sarma U, Saha B. Comprehensive logic based analyses of toll-like receptor 4 signal transduction pathway. PLoS One 2014; 9: e92481. |
39 |
Bahia MS, Kaur M, Silakari P, et al. Interleukin-1 receptor associated kinase inhibitors: potential therapeutic agents for inflammatory- and immune-related disorders. Cell Signal 2015; 27: 1039-55.
DOI URL |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
Sponsored by China Association of Chinese Medicine
& China Academy of Chinese Medical Sciences
16 Nanxiaojie, Dongzhimen Nei, Beijing, China. 100700 Email: jtcmen@126.com
Copyright 2020 Journal of Traditional Chinese Medicine. All rights reserved.